Prev. |  KEGG KO K15303 > 

RIKEN DNA Bank Human Resource - AKR7A2

Gene ID NCBI Gene 8574 |  KEGG hsa:8574
Gene Symbol AKR7A2
Protein Name aldo-keto reductase family 7 member A2
Synonyms AFAR|AFAR1|AFB1-AR1|AKR7
Ortholog resources KEGG ortholog (KEGG orthology K15303) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005846 IRAK014K06 pCMV-SPORT6 BC010852 NM_003689 Partial
HGY085683 IRAL014D11 pOTB7 BC004111 NM_003689 Partial
HGY089653 IRAL024C05 pOTB7 BC007352 NM_003689 Partial
HGY091293 IRAL028D21 pOTB7 BC013996 NM_003689 Partial
HGY091813 IRAL029I21 pOTB7 BC011586 NM_003689 Partial
HGY091877 IRAL029L13 pOTB7 BC012171 NM_003689 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235392 ARiS088H24 pGCAP10 NM_003689.2  
TGGTAGTCTCCCGCGCCGCCGTCCACTGCGCGCTTCGCTCTCCGCCGCCCGAGGCCCGCG
HKR416286 RBdS040L22 pGCAP10 NM_003689.2  
GGCGCTCGCCATGTCCCGGCCACCGCCACCGCGGGTCGCCTCGGTGCTGGGCACCATGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl