Prev. |  KEGG KO K14849 > 

RIKEN DNA Bank Human Resource - RRP1

Gene ID NCBI Gene 8568 |  KEGG hsa:8568
Gene Symbol RRP1
Protein Name ribosomal RNA processing 1
Synonyms D21S2056E|NNP-1|NOP52|RRP1A
Ortholog resource in our bank

  RRP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080466 IRAL001C18 pOTB7 BC000380 NM_003683 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168101 ARi20E05 pGCAP10 NM_003683.5  
GGTGCTGGGTACCAGGCGACTCCGGGACAGGGGGTCTCGGCCGTCGGCGTCATGGTTTCG
HKR209322 ARiS023F02 pGCAP10 NM_003683.5  
GGTGCTGGGTACCAGGCGACTCCGGGACAGGGGGTCTCGGCCGTCGGCGTCATGGTTTCG
HKR370108 RBd25E12 pGCAP10 NM_003683.5  
GAGTGTGCTGGGTACCAGGCGACTCCGGGACAGGGGGTCTCGGCCGTCGGCGTCATGGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl