Prev. |  KEGG KO K01866 > 

RIKEN DNA Bank Human Resource - YARS

Gene ID NCBI Gene 8565 |  KEGG hsa:8565
Gene Symbol YARS
Protein Name tyrosyl-tRNA synthetase
Synonyms CMTDIC|TYRRS|YRS|YTS
Ortholog resources KEGG ortholog (KEGG orthology K01866) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB13277 pUC-T7-EMCV-GST-TyrRS EMCV IRES-dependent expression vector of human tyrosyl-tRNA synthetase

RDB_org_190226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010783 IRAK026P23 pCMV-SPORT6 BC016689 NM_003680 Full
HGY081055 IRAL002K15 pOTB7 BC004151 NM_003680 Full
HGY083671 IRAL009C23 pOTB7 BC001933 NM_003680 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE042339 W01A105O03 pENTR-TOPO flj0068e10 AK125213 NM_003680  
HGE042343 W01A105O07 pENTR-TOPO flj0068e10 AK125213 NM_003680  
HGE042345 W01A105O09 pENTR-TOPO flj0068e10 AK125213 NM_003680  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047654 ARe19C06 pKA1U5 NM_003680.3  
GGGAGCGCCGAGCCCAGCTGATGCAACCTGGCTGGACTCGCGTGACAGTTCCCGGCACGC
HKR075378 ARe88H10 pKA1U5 NM_003680.3  
ATCCTGAAAGGACGCGGCGGCGACGGTGACCCANGAAGGGGCTCTGGTGCCGGGCTGAGC
HKR172508 ARi31E12 pGCAP10 NM_003680.3  
CGGCCGGCCGATGAGCTGATGCAACCTGGCTGGACTCGCGTGACAGTTCCCGGCACGCGG
HKR339755 RBb49G11 pGCAP1 NM_003680.3  
GGAGCGGGGGAAGCAGGGGTAGCGGAGCCATGGGGGACGCTCCCAGCCCTGAAGAGAAAC
HKR461718 RBdS154E22 pGCAP10 NM_003680.3  
GGACAGTTCCCGGCACGCGGCGGCGACGGTGACCCAGGAAGGGGCTCTGGTGCCGGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl