Prev. | 

RIKEN DNA Bank Human Resource - DENR

Gene ID NCBI Gene 8562 |  KEGG hsa:8562
Gene Symbol DENR
Protein Name density regulated re-initiation and release factor
Synonyms DRP|DRP1|SMAP-3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088300 IRAL020M12 pOTB7 BC007860 NM_003677 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE098832 M01C047B08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE098880 M01C047D08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE098928 M01C047F08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE098976 M01C047H08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE099024 M01C047J08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE099072 M01C047L08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE099120 M01C047N08 pDONR221 MGC13-D04 BC007860 NM_003677  
HGE099168 M01C047P08 pDONR221 MGC13-D04 BC007860 NM_003677  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171277 ARi28D05 pGCAP10 NM_003677.3  
GATTGTCTCGCGGGAGCGCTGCTGGCGGTCGGGCGCTCGGGCGGCCCTGGCCGGGGAGAC
HKR264445 ARiS161B21 pGCAP10 NM_003677.3  
AGGCTCGGGCGGCCCTGGCCGGGGAGACGAGTTGCATGTGTTGGTTCAGCTGGCGATAGC
HKR321702 RBb04E06 pKA1U5 NM_003677.3  
GGGGCGCTCGGGCGGCCCTGGCCGGGGAGACGAGTTGCATGTGTTGGTTCAGCTGGCGAT
HKR388810 RBd72A10 pGCAP10 NM_003677.3  
GAGCGCTGCTGGCGGTCGGGCGCTCGGGCGGCCCTGGCCGGGGAGACGAGTTGCATGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl