Prev. | Human A to Z list > D > 

RIKEN DNA Bank Human Resource - DEGS1

Gene ID (NCBI) 8560
Gene Symbol DEGS1
Protein Name delta(4)-desaturase, sphingolipid 1
Synonyms DEGS|DEGS-1|DES1|Des-1|FADS7|MLD
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Sphingolipid signaling pathway (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001388 IRAK003H20 pCMV-SPORT6 BC000961 NM_144780 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR162036 ARi05B12 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR170003 ARi25A03 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR059609 ARe49A09 pKA1U5 NM_003676.2  
GACCACACCAGCCGGGGTAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAG
HKR243808 ARiS109I16 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR325352 RBb13G08 pKA1U5 NM_003676.2  
HKR342076 RBb55D04 pGCAP1 NM_003676.2  
ACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl