Prev. |  KEGG KO K04712 > 

RIKEN DNA Bank Human Resource - DEGS1

Gene ID NCBI Gene 8560 |  KEGG hsa:8560
Gene Symbol DEGS1
Protein Name delta 4-desaturase, sphingolipid 1
Synonyms DEGS|DEGS-1|DES1|Des-1|FADS7|HLD18|MIG15|MLD
Featured content Sphingolipid signaling pathway (human)
Ortholog resource in our bank

  DEGS1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR059609 ARe49A09 pKA1U5 NM_003676.2 done
GACCACACCAGCCGGGGTAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAG
HKR162036 ARi05B12 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR170003 ARi25A03 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR243808 ARiS109I16 pGCAP10 NM_003676.2  
GACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGC
HKR325352 RBb13G08 pKA1U5 NM_003676.2  
HKR342076 RBb55D04 pGCAP1 NM_003676.2  
ACCACACCAGCCGGGGAGCCGCCGCCGCCGCCGCCACCTCTGAGCAGCCGGCTGGGAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl