Prev. |  KEGG KO K03729 > 

RIKEN DNA Bank Human Resource - BHLHE40

Gene ID NCBI Gene 8553 |  KEGG hsa:8553
Gene Symbol BHLHE40
Protein Name basic helix-loop-helix family member e40
Synonyms BHLHB2|Clast5|DEC1|HLHB2|SHARP-2|SHARP2|STRA13|Stra14
Ortholog resources KEGG ortholog (KEGG orthology K03729) in the DNA Bank
Featured content Circadian clock (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY103675 IRAL059D03 pOTB7 BC082238 NM_003670 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR209228 ARiS023B04 pGCAP10 NM_003670.2  
GACTCTTAGGTTTATAAATACATCAGAATGTTCTTTGCTGCCTCGCTTACATGGAAAACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl