Prev. |  KEGG KO K04442 > 

RIKEN DNA Bank Human Resource - MAPKAPK5

Gene ID NCBI Gene 8550 |  KEGG hsa:8550
Gene Symbol MAPKAPK5
Protein Name MAPK activated protein kinase 5
Synonyms MAPKAP-K5|MK-5|MK5|PRAK
Ortholog resource in our bank

  MAPKAPK5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001781 IRAK004H13 pCMV-SPORT6 BC000833 NM_139078 Partial
HGX037313 IRAK093E17 pCMV-SPORT6 BC047284 NM_139078 Full/var
HGY097767 IRAL044G23 pOTB7 BC041049 NM_139078 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR203204 ARiS008A04 pGCAP10 NM_003668.2  
GGTGGCGCTGAGGCGGCGGCGGGAGCAGCGGCGNCNANNNNGNCNTCNCCTNCNNATNNN
HKR238780 ARiS096P20 pGCAP10 NM_003668.2  
GGCTGCCCGGCGCGGGTGTCCCGGCGATGTGTGGCGCTGAGGCGGCGGCGGGAGCAGCGG
HKR394804 RBd87A04 pGCAP10 NM_003668.2  
GGGCGCGGGTGTCCCGGCGATGTGTGGCGCTGAGGCGGCGGCGGGAGCAGCGGCGCCGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl