Prev. |  KEGG KO K12397 > 

RIKEN DNA Bank Human Resource - AP3B1

Gene ID NCBI Gene 8546 |  KEGG hsa:8546
Gene Symbol AP3B1
Protein Name adaptor related protein complex 3 beta 1 subunit
Synonyms ADTB3|ADTB3A|HPS|HPS2|PE
Ortholog resources KEGG ortholog (KEGG orthology K12397) in the DNA Bank
Featured content Lysosome (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025606 IRAK064A06 pCMV-SPORT6 BC038444 NM_003664 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE093645 M01C034B21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093693 M01C034D21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093741 M01C034F21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093789 M01C034H21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093837 M01C034J21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093885 M01C034L21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093933 M01C034N21 pDONR221 MGC06-G11 BC038444 NM_003664  
HGE093981 M01C034P21 pDONR221 MGC06-G11 BC038444 NM_003664  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR386426 RBd66B02 pGCAP10 NM_003664.3  
GGCGCCTGCGCGCGCTCCTCCGTACGAGAACTAGTTTTGTTCCGTGCCCTCTGGACTGGA
HKR433215 RBdS083A15 pGCAP10 NM_003664.3  
GCCGGAAGCGCCTGCGCGCGCTCCTCCGTACGAGAACTAGTTTTGTTCCGTGCCCTCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl