Prev. | 

RIKEN DNA Bank Human Resource - CGGBP1

Gene ID NCBI Gene 8545 |  KEGG hsa:8545
Gene Symbol CGGBP1
Protein Name CGG triplet repeat binding protein 1
Synonyms CGGBP|p20-CGGBP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044183 IRAK110H15 pCMV-SPORT6 BC052980 NM_003663 Full
HGY086689 IRAL016M01 pDNR-LIB BC005222 NM_003663 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE021161 W01A052P01 pENTR-TOPO IRAK110H15 BC052980 NM_003663  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044406 ARe11A06 pKA1U5 NM_003663.3  
GGGGGGACACCCNCGGCCGCCNCGGGGCTCGATCCGTCAACNGCGGCGACGGCGGCAGCG
HKR073677 ARe84D05 pKA1U5 NM_003663.3  
GACGGCGGCCGCCGCGGGGCTCGATCGGGCAACGGCGGCGACGGCGGCAGCGACGGATCC
HKR378154 RBd45G10 pGCAP10 NM_003663.3  
TGGGACGGGGCGCGGCGGGGGACACGGCGGCCGCCGCGGGGCTCGATCGGGCAACGGCGG
HKR462477 RBdS156D05 pGCAP10 NM_003663.3  
GNTNGGCGGTGCANGCNGACGGGGCGCGGCGGGGGNCACGGCGGCCGCCGCGGGGCTCGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl