Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - API5

Gene ID (NCBI) 8539
Gene Symbol API5
Protein Name apoptosis inhibitor 5
Synonyms AAC-11|AAC11
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX006032 IRAK015B08 pCMV-SPORT6 BC015898 NM_006595 Partial
HGX011037 IRAK027J21 pCMV-SPORT6 BC017709 NM_006595 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113202 M01C083A02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113250 M01C083C02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113298 M01C083E02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113346 M01C083G02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113394 M01C083I02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113442 M01C083K02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113490 M01C083M02 pDONR221 IMS05-B01 BC017709 NM_006595  
HGE113538 M01C083O02 pDONR221 IMS05-B01 BC017709 NM_006595  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015274 W01A038D02 pENTR-TOPO IRAK027J21 BC017709 NM_006595 done
HGE015276 W01A038D04 pENTR-TOPO IRAK027J21 BC017709 NM_006595  
HGE015280 W01A038D08 pENTR-TOPO IRAK027J21 BC017709 NM_006595  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR053601 ARe34A01 pKA1U5 NM_006595.3  
GGGAGGTGTAATAGCTGCGGGTAGTGGGTTTGGNGAANTTCCGAGGCGGCGGTGGCGCCN
HKR174108 ARi35E12 pGCAP10 NM_006595.3  
GGCGGCAGCTGGAGGTGTAATAGTGCGGGTAGTGGGTTTGGAGAAGTTCCGAGGCGGCGG
HKR260215 ARiS150I23 pGCAP10 NM_006595.3  
GGCGGTGACTGNCNGCTNCACTGGCGGCAGCTGGAGGTGTAATAGTGCGGGTAGTGNGTN
HKR377226 RBd43B02 pGCAP10 NM_006595.3  
GGTGACTGGCGGCTGCACTGGCGGCAGCTGGAGGTGTAATAGTGCGGGTAGTGGGTTTGG
HKR388946 RBd72G02 pGCAP10 NM_006595.3  
GAAAAGGTATTTTTCAAGCCTCCAAGATTGTGGATCAAAAACAGCAAAACCAAGCTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.13

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl