Prev. |  KEGG KO K08794 > 

RIKEN DNA Bank Human Resource - CAMK1

Gene ID NCBI Gene 8536 |  KEGG hsa:8536
Gene Symbol CAMK1
Protein Name calcium/calmodulin dependent protein kinase I
Synonyms CAMKI
Ortholog resource in our bank

  CAMK1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05246 pAxCALNLhCAMK1(forward) Shuttle vector to generate rAd expressing human CAMK1
RDB07011 pCMFlag_hsCAMK1 Expression vector of human CAMK1.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042032 ARe05B08 pKA1U5 NM_003656.3  
GAGGCACGCAGCGGTGAGGACCGCGGCCACAGCCTCGGCGCCAACCACCGCGGGCCTCCC
HKR082148 ARf05G04 pKA1U5 NM_003656.3  
GAGGCACGCAGCGGTGAGGACCGCGGCCACAGCTCGGCGCCAACCACCGCGGGCCTCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl