Prev. |  KEGG KO K12177 > 

RIKEN DNA Bank Human Resource - COPS3

Gene ID NCBI Gene 8533 |  KEGG hsa:8533
Gene Symbol COPS3
Protein Name COP9 signalosome subunit 3
Synonyms CSN3|SGN3
Ortholog resources KEGG ortholog (KEGG orthology K12177) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083283 IRAL008D11 pOTB7 BC001891 NM_003653 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR187606 ARi69A06 pGCAP10 NM_003653.2  
GCGGGCCGCCCGGGGGAAAACATGGCGTCTGCCCTGGAGCAGTTCGTGAACAGTGTCCGA
HKR247577 ARiS118P17 pGCAP10 NM_003653.2  
GCCTTCGCCGCTCGGGCCGCCCGGGGGAAAACATGGCGTCTGCCCTGGAGCAGTTCGTGA
HKR330555 RBb26G11 pGCAP1 NM_003653.2  
GCCTTCGCCGCTCGGGCCGCCCGGGGGAAAACATGGCGTCTGCCCTGGAGCAGTTCGTGA
HKR364180 RBd10H12 pGCAP10 NM_003653.2  
GAAGTGACGTCGCCGCTCGCGAGGACCTCAGGTGGATCGCCGCGGCCCCTCCTCCCAGAG
HKR365327 RBd13F07 pGCAP10 NM_003653.2  
GGAAGTGACGTCGCCGCTCGCGAGGACCTCAGGTGGATCGCCGCGGCCCCTCCTCCCAGA
HKR395230 RBd88B06 pGCAP10 NM_003653.2  
AGGTGGATCGCCGCGGCCCCTCCTCCCAGAGCGGCAGCCTTTTCCCGCGCGTGCTGCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl