Prev. |  KEGG KO K06099 > 

RIKEN DNA Bank Human Resource - YBX3

Gene ID NCBI Gene 8531 |  KEGG hsa:8531
Gene Symbol YBX3
Protein Name Y-box binding protein 3
Synonyms CSDA|CSDA1|DBPA|ZONAB
Ortholog resources KEGG ortholog (KEGG orthology K06099) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY085022 IRAL012J06 pOTB7 BC008801 NM_003651 Full
HGY085693 IRAL014D21 pOTB7 BC009744 NM_003651 Full/var
HGY087043 IRAL017K03 pOTB7 BC015564 NM_003651 Full/var
HGY091753 IRAL029G09 pOTB7 BC015913 NM_003651 Full/var
HGY096075 IRAL040D03 pOTB7 BC021926 NM_003651

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE047407 W01A118I15 pENTR-TOPO IRAL029G09 BC015913 NM_003651  
HGE047409 W01A118I17 pENTR-TOPO IRAL029G09 BC015913 NM_003651  
HGE047415 W01A118I23 pENTR-TOPO IRAL029G09 BC015913 NM_003651  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348811 RBb72A11 pGCAP1 NM_003651.3  
GAGTAAGATCGAGCGAGGAGCCCAAGAGCGAGCGCGCAGCACGAAGCTCGAGCCGCCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl