Prev. |  KEGG KO K00901 > 

RIKEN DNA Bank Human Resource - DGKD

Gene ID NCBI Gene 8527 |  KEGG hsa:8527
Gene Symbol DGKD
Protein Name diacylglycerol kinase delta
Synonyms DGK-delta|DGKdelta|dgkd-2
Ortholog resource in our bank

  DGKD

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB02953 Human diacylglycerol kinase delta Expression vector of human diacylglycerol kinase delta

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080842 IRAL002B18 pOTB7 BC006561 NM_152879 Partial
HGY092236 IRAL030J20 pOTB7 BC032102 NM_152879 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406024 RBdS015A24 pGCAP10 NM_003648.2  
GGGCGGCGGCGNGCGCCCCTCCGCCGGGTCCCCCGCAACCGCCTCCGCCGCCGCCGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl