Prev. |  KEGG KO K11303 > 

RIKEN DNA Bank Human Resource - HAT1

Gene ID NCBI Gene 8520 |  KEGG hsa:8520
Gene Symbol HAT1
Protein Name histone acetyltransferase 1
Synonyms KAT1
Ortholog resources KEGG ortholog (KEGG orthology K11303) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR203284 ARiS008D12 pGCAP10 NM_003642.2  
GGTGATCGTAGCTCGGAAATGGCGGGATTTGGTGCTATGGAGAAATTTTTGGTAGAATAT
HKR248980 ARiS122H12 pGCAP10 NM_003642.2  
GAGCCGCGGGTGATCGTNNCNCGGAAATGGCGGGATTTGGTGCTATGGAGAAATTTTTGG
HKR377751 RBd44G07 pGCAP10 NM_003642.2  
CGAGCTCGGAAATGGCGGGTCTCCGTCTACCTTCCACTACAGTCAACTTCTGAGCTAGCG
HKR444174 RBdS110H06 pGCAP10 NM_003642.2  
GGTCCTTCCTCAGCCGCGGGTGATCGTAGCTCGGAAATGGCGGGATTTGGTGCTATGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl