Prev. | Human A to Z list > I > 

RIKEN DNA Bank Human Resource - IKBKG

Gene ID (NCBI) 8517
Gene Symbol IKBKG
Protein Name inhibitor of nuclear factor kappa B kinase subunit gamma
Synonyms AMCBX1|FIP-3|FIP3|Fip3p|IKK-gamma|IKKAP1|IKKG|IMD33|IP|IP1|IP2|IPD2|NEMO|ZC2HC9
Databases KEGG hsa:8517 |  NCBI Gene 8517
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07210)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05090 pAxCALNLhIKBKG(forward) Shuttle vector to generate rAd expressing human IKBKG
RDB05091 pAxCALNLhIKBKG(reverse) Shuttle vector to generate rAd expressing human IKBKG

RDB_org_170226.csv


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX044204 IRAK110I12 pCMV-SPORT6 BC050612 NM_003639 Full
HGY080453 IRAL001C05 pOTB7 BC000299 NM_003639 Full
HGY091948 IRAL029O12 pOTB7 BC012114 NM_003639 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR082577 ARf06H09 pKA1U5 NM_003639.3  
ATCCTGGGCGTCCTGAACGCCCATCAAGCCCATGGCCCTTGNTGATCCAGGTGGGGAAAC
HKR182854 ARi57C06 pGCAP10 NM_003639.3  
GGTGGTAGGGAAGGGCGACCGCGAAACTGGGACTTTCTCGGAGCGCCGGGGCCCTACCAG
HKR386857 RBd67C09 pGCAP10 NM_003639.3  
GAAGCCGGAAGCGTGGTAGGGAAGGGCGACCGCGAAACTGGGACTTTCTCGGAGCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.03.01

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl