DNA Bank Top |  KEGG KO K07210 > 

RIKEN DNA Bank Human Resource - IKBKG

Gene ID NCBI Gene 8517 |  KEGG hsa:8517
Gene Symbol IKBKG
Protein Name inhibitor of nuclear factor kappa B kinase regulatory subunit gamma
Synonyms AMCBX1|EDAID1|FIP-3|FIP3|Fip3p|IKK-gamma|IKKAP1|IKKG|IMD33|IP|IP1|IP2|IPD2|NEMO|SAIDX|ZC2HC9
Featured content NF-kappa B signaling pathway (human)
Featured content T cell receptor signaling pathway (human)
Featured content B cell receptor signaling pathway (human)
Featured content Apoptosis - human
Featured content SARS-CoV-2 relevant human genes
Featured content Influenza A relevant genes - human

Link

Ortholog resource in our bank

  IKBKG

External database

human IKBKG

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05091 pAxCALNLhIKBKG(reverse) Shuttle vector to generate rAd expressing human IKBKG    
RDB05090 pAxCALNLhIKBKG(forward) Shuttle vector to generate rAd expressing human IKBKG    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX044204 IRAK110I12 pCMV-SPORT6 BC050612 NM_003639 Full
HGY080453 IRAL001C05 pOTB7 BC000299 NM_003639 Full
HGY091948 IRAL029O12 pOTB7 BC012114 NM_003639 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR082577 ARf06H09 pKA1U5 NM_003639.3  
ATCCTGGGCGTCCTGAACGCCCATCAAGCCCATGGCCCTTGNTGATCCAGGTGGGGAAAC
HKR182854 ARi57C06 pGCAP10 NM_003639.3  
GGTGGTAGGGAAGGGCGACCGCGAAACTGGGACTTTCTCGGAGCGCCGGGGCCCTACCAG
HKR386857 RBd67C09 pGCAP10 NM_003639.3  
GAAGCCGGAAGCGTGGTAGGGAAGGGCGACCGCGAAACTGGGACTTTCTCGGAGCGCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl