Prev. |  KEGG KO K04883 > 

RIKEN DNA Bank Human Resource - KCNAB2

Gene ID NCBI Gene 8514 |  KEGG hsa:8514
Gene Symbol KCNAB2
Protein Name potassium voltage-gated channel subfamily A regulatory beta subunit 2
Synonyms AKR6A5|HKvbeta2|HKvbeta2.1|HKvbeta2.2|KCNA2B|KV-BETA-2
Ortholog resource in our bank

  KCNAB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE029545 W01A073O09 pENTR-TOPO flj0044h14 AK124696 NM_003636  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR399705 RBd99E09 pGCAP10 NM_003636.2  
GACGGGGCCCTGGCGCGCCAGGCTTCTCAGCCCTGCGGCGGCAGTGCATAGCTCTGGCAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl