Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NIPSNAP1

Gene ID (NCBI) 8508
Gene Symbol NIPSNAP1
Protein Name nipsnap homolog 1 (C. elegans)
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080591 IRAL001H23 pOTB7 BC002371 NM_003634 Full/var
HGY083643 IRAL009B19 pOTB7 BC006473 NM_003634 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR171280 ARi28D08 pGCAP10 NM_003634.2
GGTGTGCAGCATCTCTGTGACGGCGCGGCGGCTGCTGGGGGGCCCGGGGCCTCGCGCTGG
HKR174550 ARi36G06 pGCAP10 NM_003634.2
GGTGTGCAGCATCTCTGTGACGGCGCGGCGGCTGCTGGGGGGCCCGGGGCCTCGCGCTGG
HKR390922 RBd77F02 pGCAP10 NM_003634.2
GGGGCGGGGCCTTCCTGCAACCTTTGCGGCTCCAACATGGCTCCGCGGCTGTGCAGCATC
HKR416173 RBdS040H05 pGCAP10 NM_003634.2
GGCGGCTCCAACATGGCTCCGCGGCTGTGCAGCATCTCTGTGACGGCGCGGCGGCTGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl