Prev. |  KEGG KO K07759 > 

RIKEN DNA Bank Human Resource - PARG

Gene ID NCBI Gene 8505 |  KEGG hsa:8505
Gene Symbol PARG
Protein Name poly(ADP-ribose) glycohydrolase
Synonyms PARG99
Ortholog resources KEGG ortholog (KEGG orthology K07759) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX039412 IRAK098I20 pCMV-SPORT6 BC052966 NM_003631 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE105647 M01C064B23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105695 M01C064D23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105743 M01C064F23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105791 M01C064H23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105839 M01C064J23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105887 M01C064L23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105935 M01C064N23 pDONR221 06_06-G12 BC052966 ENST00000327977  
HGE105983 M01C064P23 pDONR221 06_06-G12 BC052966 ENST00000327977  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048980 ARe22H12 pKA1U5 NM_003631.2 done
GAGGCAGGTGGGGTGCCAGTGGAAGAGGGAAGGCAGGCGAGTGTTTACGGCCTGACTTGG
HKR332924 RBb32F04 pGCAP1 NM_003631.2 done
GGCAGGTGGGGTGCCAGTGGAAGAGGGAAGGCAGGCGAGTGTTTACGGCCTGACTTGGGA
HKR416345 RBdS040O09 pGCAP10 NM_003631.2  
GGAACGNNTCCCGAATCAAAGCGGCGCATTGAGGCAGGTGGGGTGCCAGTGGAAGAGAGA
HKR462675 RBdS156L11 pGCAP10 NM_003631.2 done
GGGAANCGCCTGACGGCAGCTTTCCGGTGGTGGGAAAGTGAACGAATCCCGAATCAAAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl