Prev. |  KEGG KO K09624 > 

RIKEN DNA Bank Human Resource - PRSS12

Gene ID NCBI Gene 8492 |  KEGG hsa:8492
Gene Symbol PRSS12
Protein Name serine protease 12
Synonyms BSSP-3|BSSP3|MRT1
Ortholog resource in our bank

  PRSS12

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086986 IRAL017H18 pOTB7 BC007761 NM_003619 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042012 ARe05A12 pKA1U5 NM_003619.2  
GCTCTCTTTTCCGGTCCTCTCCGCCGGCCGGGGCTCGGCTGAGCTCCAGATTTCCCCACC
HKR167632 ARi19B08 pGCAP10 NM_003619.2  
ATTTCCCCACCCGCGGCCGCCGCCAGGGGACAGGAGCCGAGGCGCGGCAGGGCACCAGCG
HKR188131 ARi70F11 pGCAP10 NM_003619.2  
GCAACCAGACCCCGCAGCGCTGGCACCATGACGCTCGCCCGCTTCNTGCTAGCCCTGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl