Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GEMIN2

Gene ID (NCBI) 8487
Gene Symbol GEMIN2
Protein Name gem nuclear organelle associated protein 2
Synonyms SIP1|SIP1-delta
Databases KEGG hsa:8487 |  NCBI Gene 8487
Featured content Ortholog resources in the DNA Bank (KEGG orthology K13130)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR461876 RBdS154L12 pGCAP10 NM_001009182.1  
TGGGCTGGTTTGAAAACCATGGCGTGGGTACCAGCGGAGTCCGCAGTGGAAGAGTTGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl