Prev. | 

RIKEN DNA Bank Human Resource - HIRIP3

Gene ID NCBI Gene 8479 |  KEGG hsa:8479
Gene Symbol HIRIP3
Protein Name HIRA interacting protein 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082004 IRAL005A04 pOTB7 BC000588 NM_003609 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018656 W01A046K16 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018658 W01A046K18 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018662 W01A046K22 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018690 W01A046M02 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018692 W01A046M04 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018694 W01A046M06 pENTR-TOPO IRAL005A04 BC000588 NM_003609  
HGE018696 W01A046M08 pENTR-TOPO IRAL005A04 BC000588 NM_003609  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR370171 RBd25H03 pGCAP10 NM_003609.2  
GCCCGGGTTGAGCAAAATGGCGCGGGAGAAGGAGATGCAGGAGTTCACCCGTAGCTTCTT
HKR395633 RBd89B09 pGCAP10 NM_003609.2  
GGCGAGCCGCTGTCAAACGCGCTGACGGAGGCCGAGAAGAAAAAAAGGCGGGAGCCGTCA
HKR470964 RBdS177G20 pGCAP10 NM_003609.2  
GAAGTCAGGCACGTAGCTCAGCGGCGGCCGCGGCGCGTGCGTCTGTGCCTCTGCGCGGGT
HKR470965 RBdS177G21 pGCAP10 NM_003609.2  
GGGGAGCCGTCAATCCCGGGTTGAGCAAAATGGCGCGGGAGAAGGAGATGCAGGAGTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl