Prev. |  KEGG KO K11654 > 

RIKEN DNA Bank Human Resource - SMARCA5

Gene ID NCBI Gene 8467 |  KEGG hsa:8467
Gene Symbol SMARCA5
Protein Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5
Synonyms ISWI|SNF2H|WCRF135|hISWI|hSNF2H
Ortholog resource in our bank

  SMARCA5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04820 SEREX clone NGO-Pr-169 5' (ID 2522); NGO-Pr-169 3' (ID 2523) #1 SEREX clone NGO-Pr-169 5' (ID 2522); NGO-Pr-169 3' (ID 2523) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010610 IRAK026I18 pCMV-SPORT6 BC023144 NM_003601 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024087 W01A060D15 pENTR-TOPO IRAK026I18 BC023144 NM_003601  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR183201 ARi58A01 pGCAP10 NM_003601.2  
GCCGGTGGAACCTAGAGCCCCGCGGAAGAGCAGAACGTTTGGGAGTGTGCAGCTCCTGGG
HKR347678 RBb69D06 pGCAP1 NM_003601.2  
ATAGATGTTATCTTCCAGAGGAAGAGGAGGAGGCGGCGAAGCGTTTTCCCAGCCTCAGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl