Prev. |  KEGG KO K03869 > 

RIKEN DNA Bank Human Resource - CUL3

Gene ID NCBI Gene 8452 |  KEGG hsa:8452
Gene Symbol CUL3
Protein Name cullin 3
Synonyms CUL-3|PHA2E
Ortholog resource in our bank

  CUL3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033908 IRAK084M20 pCMV-SPORT6 BC039598 NM_003590 Full
HGX008545 IRAK021G01 pCMV-SPORT6 BC031844 NM_003590 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR172976 ARi32H08 pGCAP10 NM_003590.3  
TGCCACCTCCCTCCCCCGGCATCTCTCANTCTCCGGCTCTCCTCCCTCCCTCCTCCCCTC
HKR395321 RBd88F01 pGCAP10 NM_003590.3  
GGAGGAGGACGACGTTCGGCCTGCGCAGTGAGATGTTTGTCCGTCGCCGCCGCCGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl