Prev. |  KEGG KO K10609 > 

RIKEN DNA Bank Human Resource - CUL4B

Gene ID NCBI Gene 8450 |  KEGG hsa:8450
Gene Symbol CUL4B
Protein Name cullin 4B
Synonyms CUL-4B|MRXHF2|MRXS15|MRXSC|SFM2
Ortholog resources KEGG ortholog (KEGG orthology K10609) in the DNA Bank
Featured content DNA repair (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY025391 IRAK063H23 pBluescriptR BC036216 NM_003588 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178529 ARi46F09 pGCAP10 NM_003588.3  
GGTTTACCTGTCTGCCTCCTCATTCGCTCTCCCCCCTCGTTCTGCTCACTCCTGGTGTCA
HKR322926 RBb07F06 pKA1U5 NM_003588.3  
ATCCTGCTCATTCGCTCTCCCCCCTCGTTCTGCTCANTCCTGGTGTCAGCCTATCCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl