Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CUL4B

Gene ID (NCBI) 8450
Gene Symbol CUL4B
Protein Name cullin 4B
Synonyms MRXHF2|MRXS15|MRXSC|SFM2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content DNA repair (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY025391 IRAK063H23 pBluescriptR BC036216 NM_003588 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR178529 ARi46F09 pGCAP10 NM_003588.3
GGTTTACCTGTCTGCCTCCTCATTCGCTCTCCCCCCTCGTTCTGCTCACTCCTGGTGTCA
HKR322926 RBb07F06 pKA1U5 NM_003588.3
ATCCTGCTCATTCGCTCTCCCCCCTCGTTCTGCTCANTCCTGGTGTCAGCCTATCCGCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl