Prev. |  KEGG KO K00649 > 

RIKEN DNA Bank Human Resource - GNPAT

Gene ID NCBI Gene 8443 |  KEGG hsa:8443
Gene Symbol GNPAT
Protein Name glyceronephosphate O-acyltransferase
Synonyms DAP-AT|DAPAT|DHAPAT|RCDP2
Ortholog resource in our bank

  GNPAT

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080529 IRAL001F09 pOTB7 BC000450 NM_014236 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE016122 W01A040F02 pENTR-TOPO IRAL001F09 BC000450 NM_014236  
HGE016126 W01A040F06 pENTR-TOPO IRAL001F09 BC000450 NM_014236  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR386129 RBd65F09 pGCAP10 NM_014236.3  
GGCTTCCGTCCTGGCTGAGATGGCGGCGCCCGGGATCCTGTGTAGCGGCTGCAGAGGGTG
HKR392811 RBd82A11 pGCAP10 NM_014236.3  
GGGGCCGTCCTGAGCGAAAGAACCGCCCCCAGCAGGAGCACCACCACGGTTTAGCAAAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl