Prev. |  KEGG KO K17461 > 

RIKEN DNA Bank Human Resource - RECK

Gene ID NCBI Gene 8434 |  KEGG hsa:8434
Gene Symbol RECK
Protein Name reversion inducing cysteine rich protein with kazal motifs
Synonyms ST15
Ortholog resource in our bank

  RECK

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078127 ARe95F07 pKA1U5 NM_021111.2  
GGCGCGAGCGGCGGCGGTAGCGGCGGCAGCGGCTGCGGCCAAGCTGGGTCCGAGCATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl