Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RECK

Gene ID (NCBI) 8434
Gene Symbol RECK
Protein Name reversion inducing cysteine rich protein with kazal motifs
Synonyms ST15
Databases KEGG hsa:8434 |  NCBI Gene 8434
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17461)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078127 ARe95F07 pKA1U5 NM_021111.2  
GGCGCGAGCGGCGGCGGTAGCGGCGGCAGCGGCTGCGGCCAAGCTGGGTCCGAGCATCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl