Prev. |  KEGG KO K08838 > 

RIKEN DNA Bank Human Resource - STK24

Gene ID NCBI Gene 8428 |  KEGG hsa:8428
Gene Symbol STK24
Protein Name serine/threonine kinase 24
Synonyms HEL-S-95|MST3|MST3B|STE20|STK3
Ortholog resource in our bank

  STK24

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027881 IRAK069L17 pCMV-SPORT6 BC035578 NM_001032296 Full/var
HGY100384 IRAL050P24 pOTB7 BC065378 NM_001032296 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062971 ARe57H03 pKA1U5 NM_003576.3  
GGAGTAGCTTGAAGAGAGACCACAGGGAAGGCANGCNCAGAGCTGGGGACTGTGAGAGCC
HKR208299 ARiS020M11 pGCAP10 NM_003576.3  
GACTCCGGCTCCNNCNGCCAGCGCGCGCGGGCCCAGGCCGCCCGGCTCCAGCCCAGCAGT
HKR260049 ARiS150C01 pGCAP10 NM_003576.3  
GGCCCACTCCGGCTCCAGCGNCCAGCGCGCGCGGGCCCAGGCCGCCCGGCTCCAGCCCAG
HKR387779 RBd69H11 pGCAP10 NM_003576.3  
GACTCCGNCTCCAGCGGCCAGCGCGCGCGGGCCCAGGCCGCCCGGCTCCAGCCCAGCAGT
HKR392428 RBd81B04 pGCAP10 NM_003576.3  
GGGCGGGCTGTGCGCGCCCACTCCGGCTCCAGCGGCCAGCGCGCGCGGGCCCAGGCCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl