Prev. | Human A to Z list > E > 

RIKEN DNA Bank Human Resource - EEA1

Gene ID (NCBI) 8411
Gene Symbol EEA1
Protein Name early endosome antigen 1
Synonyms MST105|MSTP105|ZFYVE2
Databases KEGG hsa:8411 |  NCBI Gene 8411
Featured content Endocytosis (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12478)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR026834 ARa67B10 pKA1U5 NM_003566.3  
GGGAGGCGCTCGCAGGCTGCCTAGTCGTTCGCTCGCTCTCTCTCGCGTGCTCCCTCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl