Prev. |  KEGG KO K12478 > 

RIKEN DNA Bank Human Resource - EEA1

Gene ID NCBI Gene 8411 |  KEGG hsa:8411
Gene Symbol EEA1
Protein Name early endosome antigen 1
Synonyms MST105|MSTP105|ZFYVE2
Featured content Endocytosis (human)
Ortholog resource in our bank

  EEA1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19416 pFX-EGFP-EEA1 Expression vector of EGFP with early endosome-targeting sequence (human EEA1) in mammalian cells.

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR026834 ARa67B10 pKA1U5 NM_003566.3 VA done
GGGAGGCGCTCGCAGGCTGCCTAGTCGTTCGCTCGCTCTCTCTCGCGTGCTCCCTCTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.08.14

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl