Prev. |  KEGG KO K10523 > 

RIKEN DNA Bank Human Resource - SPOP

Gene ID NCBI Gene 8405 |  KEGG hsa:8405
Gene Symbol SPOP
Protein Name speckle type BTB/POZ protein
Synonyms BTBD32|TEF2
Ortholog resource in our bank

  SPOP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001396 IRAK003I04 pCMV-SPORT6 BC003385 NM_003563 Full
HGX001870 IRAK004L06 pCMV-SPORT6 BC001269 NM_003563 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006082 W01A015D10 pENTR-TOPO IRAK003I04 BC003385 NM_003563  
HGE006086 W01A015D14 pENTR-TOPO IRAK003I04 BC003385 NM_003563  
HGE006090 W01A015D18 pENTR-TOPO IRAK004L06 BC001269 NM_003563  
HGE006092 W01A015D20 pENTR-TOPO IRAK004L06 BC001269 NM_003563  
HGE006094 W01A015D22 pENTR-TOPO IRAK004L06 BC001269 NM_003563  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074054 ARe85C06 pKA1U5 NM_003563.3  
GGCTGGTGTGTGTCGGTGTGTATGTGTGTGTGTGAGTGTGCGCGCTCCGAGTGTGTGTGT
HKR361228 RBd03B04 pGCAP10 NM_003563.3  
GGTATTTGTGTATCGGCGGTCCCGCAGGTCCCGGATGTTGCGGACAGTATGAGGCAAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl