Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - H2AC20

Gene ID NCBI Gene 8338 |  KEGG hsa:8338
Gene Symbol H2AC20
Protein Name H2A clustered histone 20
Synonyms H2A|H2A-GL101|H2A/q|H2AFQ|HIST2H2AC
Ortholog resource in our bank

  H2AC20

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053694 IRAK134D22 pCMV-SPORT6 BC060324 NM_003517 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045178 W01A112P18 pENTR-TOPO IRAK134D22 BC060324 NM_003517  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR171324 ARi28F04 pGCAP10 NM_003517.2  
GAATCTTATTTTGTTGCGAGGTTCTGAGCGTTGTCTGTGTTTAACCTTGATTTCAGTCAT
HKR373780 RBd34H12 pGCAP10 NM_003517.2  
GGACTTTCCCGATCGCCAGGCAGGAGTTTCTCTCGGTGACTACTATCGCTGTCATGTCTG
HKR384129 RBd60F09 pGCAP10 NM_003517.2  
TGGACTTTCCCGATCGCCAGGCAGGAGTTTCTCTCGGTGACTACTATCGCTGTCATGTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl