Prev. |  KEGG KO K11251 > 

RIKEN DNA Bank Human Resource - HIST2H2AA3

Gene ID NCBI Gene 8337 |  KEGG hsa:8337
Gene Symbol HIST2H2AA3
Protein Name histone cluster 2 H2A family member a3
Synonyms H2A|H2A.2|H2A/O|H2A/q|H2AFO|H2a-615|HIST2H2AA
Ortholog resources KEGG ortholog (KEGG orthology K11251) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083523 IRAL008N11 pOTB7 BC001629 NM_003516 Full
HGY083616 IRAL009A16 pOTB7 BC019308 NM_003516 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE004005 W01A010A05 pENTR-TOPO IRAL008N11 BC001629 NM_003516  
HGE004007 W01A010A07 pENTR-TOPO IRAL008N11 BC001629 NM_003516  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR187697 ARi69E01 pGCAP10 NM_003516.2  
CGGACTTTCCCGATCGCCAGGCAGGAGTTTCTCTCGGTGACTACTATCGCTGTCATGTCT
HKR393252 RBd83C04 pGCAP10 NM_003516.2  
GGACTTTCCCGATCGCCAGGCAGGAGTTTCTCTCGGTGACTACTATCGCTGTCATGTCTG
HKR428275 RBdS070L11 pGCAP10 NM_003516.2  
GGACTTTCCCGATCGCCAGGCAGGAGTTTCTCTCGGTGACTACTATCGCTGTCATGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl