Prev. |  KEGG KO K06628 > 

RIKEN DNA Bank Human Resource - CDC45

Gene ID NCBI Gene 8318 |  KEGG hsa:8318
Gene Symbol CDC45
Protein Name cell division cycle 45
Synonyms CDC45L|CDC45L2|MGORS7|PORC-PI-1
Ortholog resources KEGG ortholog (KEGG orthology K06628) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086031 IRAL015B07 pOTB7 BC006232 NM_003504 Full
HGY090815 IRAL027A15 pOTB7 BC010022 NM_003504 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007772 W01A019H04 pENTR-TOPO IRAL015B07 BC006232 NM_003504 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067202 ARe68A02 pKA1U5 NM_003504.3  
GGCGAGCGCCAGGCGTCCGGCCGCCGTGGCTATGTTTCGTGTCCGATTTCCGCAAAGAGT
HKR392436 RBd81B12 pGCAP10 NM_003504.3  
GACCTCAGCGCGAGCGCCAGGCGTCCGGCCGCCGTGGCTATGTTCGTGTCCGATTTCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl