Prev. |  KEGG KO K02214 > 

RIKEN DNA Bank Human Resource - CDC7

Gene ID NCBI Gene 8317 |  KEGG hsa:8317
Gene Symbol CDC7
Protein Name cell division cycle 7
Synonyms CDC7L1|HsCDC7|Hsk1|huCDC7
Ortholog resources KEGG ortholog (KEGG orthology K02214) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055777 ARe39H09 pKA1U5 NM_003503.2  
GAGAGCGGCGGCGGGAAGTGTTGCGCAGGCGCATCCGATCGACTCGCTGCTTTGCTCCCC
HKR384428 RBd61B04 pGCAP10 NM_003503.2  
GAGGCGCATCCGATCGACTCGGTAGGTGGGGATCTCTTGGAGACGGCGACCCAGGCATCT
HKR388453 RBd71C05 pGCAP10 NM_003503.2  
GAGGTGGGGATCTCTTGGAGACGGCGACCCAGGCATCTGGGGAGCCACAGAAGTCGTACT
HKR394902 RBd87E06 pGCAP10 NM_003503.2  
GGGGAAGTGTTGCGCAGGCGCATCCGATCGACTCGGTAGGTGGGGATCTCTTGGAGACGG
HKR433295 RBdS083D23 pGCAP10 NM_003503.2  
ATTTCACCCTTCTCCTCCTCCGCCCAGTACTCGTGGCCAGGGTCGTATCAGTTCTCCGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl