Prev. | 

RIKEN DNA Bank Human Resource - SNN

Gene ID NCBI Gene 8303 |  KEGG hsa:8303
Gene Symbol SNN
Protein Name stannin
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013392 IRAK033H24 pBluescriptR BC036443 NM_003498 Full
HGY019362 IRAK048G18 pBluescriptR BC036100 NM_003498 Full
HGY080945 IRAL002G01 pOTB7 BC005837 NM_003498 Partial
HGY083793 IRAL009I01 pOTB7 BC005837 NM_003498 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR453138 RBdS132O02 pGCAP10 NM_003498.4  
GGAGTGCGCGGCGGCCGGACCGGGCGGGCGGAGCCGGGCCCGCGGGGCTGCTGCGGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl