Prev. | 

RIKEN DNA Bank Human Resource - SERF1A

Gene ID NCBI Gene 8293 |  KEGG hsa:8293
Gene Symbol SERF1A
Protein Name small EDRK-rich factor 1A
Synonyms 4F5|FAM2A|H4F5|SERF1|SMAM1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018691 IRAK046M03 pBluescriptR BC021174 NM_021967
HGY094811 IRAL037A11 pDNR-LIB BC035932 NM_021967 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099610 M01C049A10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099658 M01C049C10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099706 M01C049E10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099754 M01C049G10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099802 M01C049I10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099850 M01C049K10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099898 M01C049M10 pDONR221 MGC14-B05 BC021174 ENST00000317633  
HGE099946 M01C049O10 pDONR221 MGC14-B05 BC021174 ENST00000317633  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR042010 ARe05A10 pKA1U5 NM_021967.2  
GGAGGGCTCAGCCTTCCCGGTCAGCGGTGGTGACGGTATCCCAGAGTGCCAGAGAACCGT
HKR203499 ARiS008M11 pGCAP10 NM_021967.2  
GGGCCATGCCGGCNNCTGTTGTCGGGCCTCCAGCGGGCGGGGCCGTTGGCGGAGCAGAGG
HKR320882 RBb02D10 pKA1U5 NM_021967.2  
GGCGCACGCGCAGTGACGCGCCGGCCATGCCGGCGGCTGTTGTCGGGCCTCCAGCGGGCG
HKR376571 RBd41H03 pGCAP10 NM_021967.2  
CCGGTGACGGTATCCCAGAGTGCCAGAGAACCGTTGCTTTTCCGAGTTGCTCTTCTTCCA
HKR474886 RBdS187D14 pGCAP10 NM_021967.2  
GGCAGTGACGCGCCGGCCATGCCGGCGGCTGTTGTCGGGCCTCCAGCGGGCGGGGCCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl