Prev. | Human A to Z list > L > 

RIKEN DNA Bank Human Resource - LAGE3

Gene ID (NCBI) 8270
Gene Symbol LAGE3
Protein Name L antigen family, member 3
Synonyms CVG5|DXS9879E|DXS9951E|ESO3|ITBA2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY092168 IRAL030G24 pOTB7 BC019012 NM_006014 Partial
HGY093923 IRAL034N11 pOTB7 BC015744 NM_006014 Full
HGY100204 IRAL050I12 pOTB7 BC062330 NM_006014 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE088405 M01C021A05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088453 M01C021C05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088501 M01C021E05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088549 M01C021G05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088597 M01C021I05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088645 M01C021K05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088693 M01C021M05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE088741 M01C021O05 pDONR221 IMS03-A03 BC015744 NM_006014
HGE100809 M01C052A09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE100857 M01C052C09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE100905 M01C052E09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE100953 M01C052G09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE101001 M01C052I09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE101049 M01C052K09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE101097 M01C052M09 pDONR221 MGC15-E05 BC015744 NM_006014
HGE101145 M01C052O09 pDONR221 MGC15-E05 BC015744 NM_006014

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE047541 W01A118O05 pENTR-TOPO IRAL034N11 BC015744 NM_006014
HGE047547 W01A118O11 pENTR-TOPO IRAL034N11 BC015744 NM_006014

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR408815 RBdS022A15 pGCAP10 NM_006014.3
GGCAGGCGGAGGCGCTGACGGCGGGGATGGCCGGGGTGGCCACAGCTGCCGCGGGGGCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl