Prev. | 

RIKEN DNA Bank Human Resource - UBL4A

Gene ID NCBI Gene 8266 |  KEGG hsa:8266
Gene Symbol UBL4A
Protein Name ubiquitin like 4A
Synonyms DX254E|DXS254E|G6PD|GDX|GET5|MDY2|TMA24|UBL4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035924 IRAK089N12 pCMV-SPORT6 BC043346 NM_014235 Full
HGX046114 IRAK115E18 pCMV-SPORT6 BC053589 NM_014235 Full
HGY096231 IRAL040J15 pOTB7 BC020254 NM_014235

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR067680 ARe69D08 pKA1U5 NM_014235.3  
GGGTGAAGGCGCTGCAGGGCCGCGAGTGCAGCCTGCAGGTGCCAGAGGACGAGCTGGTGT
HKR074977 ARe87H09 pKA1U5 NM_014235.3  
CGAAGGCGCTGCAGGGCCGCGAGTGCAGCCTGCAGGTGCCAGAGGACGAGCTGGTGTCCA
HKR188098 ARi70E02 pGCAP10 NM_014235.3  
GGACGCCGTCGCGACCGCCATGCAGCTGACGGTGAAGGCGCTGCAGGGCCGCGAGTGCAG
HKR474955 RBdS187G11 pGCAP10 NM_014235.3  
GGGACGCCGTCGCGACCGCCATGCAGCTGACGGTGAAGGCGCTGCAGGGCCGCGAGTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl