Prev. |  KEGG KO K20135 > 

RIKEN DNA Bank Human Resource - F8A1

Gene ID NCBI Gene 8263 |  KEGG hsa:8263
Gene Symbol F8A1
Protein Name coagulation factor VIII associated 1
Synonyms DXS522E|F8A|HAP40
Ortholog resource in our bank

  F8A1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX027558 IRAK068O22 pCMV-SPORT6 BC039693 -
HGY103357 IRAL058G13 pOTB7 BC071963 -

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113230 M01C083B06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113278 M01C083D06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113326 M01C083F06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113374 M01C083H06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113422 M01C083J06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113470 M01C083L06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113518 M01C083N06 pDONR221 IMS05-D03 BC039693 NM_012151  
HGE113566 M01C083P06 pDONR221 IMS05-D03 BC039693 NM_012151  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR040825 ARe02B01 pKA1U5 NM_012151.3  
GGGGGCGGCGAGCATGGCGGCAGCGGCTGCAGGCCTGGGCGGCGGCGGCGCCGGCCCGGG
HKR327657 RBb19C09 pKA1U5 NM_012151.3  
GGCGAGCATGGCGGCAGCGGCTGCAGGCCTGGGCGGNGGCGGCGCCGGCCCGGGACCCGA
HKR330556 RBb26G12 pGCAP1 NM_012151.3  
GGGGGCGGCGAGCATGGCGGCAGCGGCTGCAGGCCTGGGCGGCGGCGGCGCCGGCCCGGG
HKR396476 RBd91D04 pGCAP10 NM_012151.3  
GGGGCGGCGAGCATGGCGGCAGCGGCTGCAGGCCTGGGCGGCGGCGGCGCCGGCCCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl