Prev. |  KEGG KO K20791 > 

RIKEN DNA Bank Human Resource - NAA10

Gene ID NCBI Gene 8260 |  KEGG hsa:8260
Gene Symbol NAA10
Protein Name N-alpha-acetyltransferase 10, NatA catalytic subunit
Synonyms ARD1|ARD1A|ARD1P|DXS707|MCOPS1|NATD|OGDNS|TE2|hARD1
Ortholog resource in our bank

  NAA10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080499 IRAL001E03 pOTB7 BC000308 NM_003491
HGY083673 IRAL009D01 pOTB7 BC019312 NM_003491 Full
HGY100009 IRAL050A09 pOTB7 BC063377 NM_003491 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045613 W01A114A13 pENTR-TOPO IRAL001E03 BC000308 NM_003491  
HGE045615 W01A114A15 pENTR-TOPO IRAL001E03 BC000308 NM_003491  
HGE045621 W01A114A21 pENTR-TOPO IRAL001E03 BC000308 NM_003491  
HGE045623 W01A114A23 pENTR-TOPO IRAL001E03 BC000308 NM_003491  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR069675 ARe74D03 pKA1U5 NM_003491.2  
GGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGG
HKR344073 RBb60D01 pGCAP1 NM_003491.2  
AAGCCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCG
HKR346952 RBb67G08 pGCAP1 NM_003491.2  
AAGCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGT
HKR372531 RBd31F11 pGCAP10 NM_003491.2  
GCGGCCGGTGGCCGGCCCGGCGCGCACCGCCCCTTCCGCCGTCGCCCAGCGAGCCCAGCT
HKR395356 RBd88G12 pGCAP10 NM_003491.2  
GGCGCACCGCCCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGT
HKR416194 RBdS040I02 pGCAP10 NM_003491.2  
GGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGGAGCGCG
HKR430162 RBdS075G18 pGCAP10 NM_003491.2  
GCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCG
HKR430164 RBdS075G20 pGCAP10 NM_003491.2  
GCTAACCTGGTCCGGAGCGAGTCTGGGTCTCAGCCCCGCGAACAGCCTTTCACGAGTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl