Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NAA10

Gene ID (NCBI) 8260
Gene Symbol NAA10
Protein Name N(alpha)-acetyltransferase 10, NatA catalytic subunit
Synonyms ARD1|ARD1A|ARD1P|DXS707|NATD|TE2
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080499 IRAL001E03 pOTB7 BC000308 NM_003491
HGY083673 IRAL009D01 pOTB7 BC019312 NM_003491 Full
HGY100009 IRAL050A09 pOTB7 BC063377 NM_003491 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE045613 W01A114A13 pENTR-TOPO IRAL001E03 BC000308 NM_003491
HGE045615 W01A114A15 pENTR-TOPO IRAL001E03 BC000308 NM_003491
HGE045621 W01A114A21 pENTR-TOPO IRAL001E03 BC000308 NM_003491
HGE045623 W01A114A23 pENTR-TOPO IRAL001E03 BC000308 NM_003491

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR069675 ARe74D03 pKA1U5 NM_003491.2
GGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGG
HKR372531 RBd31F11 pGCAP10 NM_003491.2
GCGGCCGGTGGCCGGCCCGGCGCGCACCGCCCCTTCCGCCGTCGCCCAGCGAGCCCAGCT
HKR344073 RBb60D01 pGCAP1 NM_003491.2
AAGCCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCG
HKR346952 RBb67G08 pGCAP1 NM_003491.2
AAGCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGT
HKR395356 RBd88G12 pGCAP10 NM_003491.2
GGCGCACCGCCCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGT
HKR416194 RBdS040I02 pGCAP10 NM_003491.2
GGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGGAGCGCG
HKR430162 RBdS075G18 pGCAP10 NM_003491.2
GCCTTCCGCCGTCGCCCAGCGAGCCCAGCTCCGGTCCCAGCCCCGGCCGTCCCGGCGTCG
HKR430164 RBdS075G20 pGCAP10 NM_003491.2
GCTAACCTGGTCCGGAGCGAGTCTGGGTCTCAGCCCCGCGAACAGCCTTTCACGAGTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl