Prev. |  KEGG KO K06636 > 

RIKEN DNA Bank Human Resource - SMC1A

Gene ID NCBI Gene 8243 |  KEGG hsa:8243
Gene Symbol SMC1A
Protein Name structural maintenance of chromosomes 1A
Synonyms CDLS2|DXS423E|SB1.8|SMC1|SMC1L1|SMC1alpha|SMCB
Ortholog resource in our bank

  SMC1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055699 IRAK139E03 pCMV-SPORT6 BC064368 NM_006306 Partial
HGX069773 IRAK174H05 pCMV-SPORT6 BC080185 NM_006306 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405568 RBdS013P08 pGCAP10 NM_006306.2  
GAGTTCTCGGGCGTACGGCGCGGCCTGTCCTACTGCCGCCGGCGCCGCGGCCGTCATGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl