Prev. |  KEGG KO K11835 > 

RIKEN DNA Bank Human Resource - USP11

Gene ID NCBI Gene 8237 |  KEGG hsa:8237
Gene Symbol USP11
Protein Name ubiquitin specific peptidase 11
Synonyms UHX1
Ortholog resources KEGG ortholog (KEGG orthology K11835) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053646 IRAK134B22 pCMV-SPORT6 BC063668 NM_004651 Partial
HGX069895 IRAK174M07 pCMV-SPORT6 BC073960 NM_004651 Partial/var
HGY080699 IRAL001M11 pOTB7 BC000350 NM_004651 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE016903 W01A042E07 pENTR-TOPO flj0052d01 AK098394 NM_004651  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR190978 ARi77H10 pGCAP10 NM_004651.3  
CGGCCGGCCGATTGGAGCTGAGGCAGAAAATGGCGCCTGCGAATAAGCAAAGTTTATGA
HKR364179 RBd10H11 pGCAP10 NM_004651.3  
GACAGCTGCGTTGGCTGTAGAAGAGAACGGACGGCGATGGCGACGGTCGCAGCAAATCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl