Prev. |  KEGG KO K17623 > 

RIKEN DNA Bank Human Resource - PUDP

Gene ID NCBI Gene 8226 |  KEGG hsa:8226
Gene Symbol PUDP
Protein Name pseudouridine 5'-phosphatase
Synonyms DXF68S1E|FAM16AX|GS1|HDHD1|HDHD1A
Ortholog resources KEGG ortholog (KEGG orthology K17623) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011277 IRAK028D05 pCMV-SPORT6 BC012494 NM_012080 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR346481 RBb66D09 pGCAP1 NM_012080.3  
HKR398525 RBd96F05 pGCAP10 NM_012080.3  
GACCCAGACCCAGAAGGCGCCACCATGGCGGCGCCCCCGCAGCCCGTCACCCACCTCATC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl