Prev. | 

RIKEN DNA Bank Human Resource - GATD3A

Gene ID NCBI Gene 8209 |  KEGG hsa:8209
Gene Symbol GATD3A
Protein Name glutamine amidotransferase like class 1 domain containing 3A
Synonyms C21orf33|ES1|GATD3|GT335|HES1|KNPH|KNPI
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080589 IRAL001H21 pOTB7 BC002370 NM_004649 Full
HGY083931 IRAL009N19 pOTB7 BC003587 NM_004649 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR330884 RBb27D12 pGCAP1 NM_004649.5  
GGTCCTCACCGCAATGGCGGCTGTGAGGGCCCTGGTGGCCTCGAGGCTCGCTGCGGCATC
HKR345674 RBb64D02 pGCAP1 NM_004649.5  
GCCCTGCGTGACCTTCCGACCCCGCTGTCCTCACCGCAATGGCGGCTGTGAGGGCCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl