Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C21orf33

Gene ID (NCBI) 8209
Gene Symbol C21orf33
Protein Name chromosome 21 open reading frame 33
Synonyms ES1|GT335|HES1|KNPH|KNPI
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080589 IRAL001H21 pOTB7 BC002370 NM_004649 Full
HGY083931 IRAL009N19 pOTB7 BC003587 NM_004649 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR330884 RBb27D12 pGCAP1 NM_004649.5
GGTCCTCACCGCAATGGCGGCTGTGAGGGCCCTGGTGGCCTCGAGGCTCGCTGCGGCATC
HKR345674 RBb64D02 pGCAP1 NM_004649.5
GCCCTGCGTGACCTTCCGACCCCGCTGTCCTCACCGCAATGGCGGCTGTGAGGGCCCTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl