Prev. |  KEGG KO K10751 > 

RIKEN DNA Bank Human Resource - CHAF1B

Gene ID NCBI Gene 8208 |  KEGG hsa:8208
Gene Symbol CHAF1B
Protein Name chromatin assembly factor 1 subunit B
Synonyms CAF-1|CAF-IP60|CAF1|CAF1A|CAF1P60|MPHOSPH7|MPP7
Ortholog resources KEGG ortholog (KEGG orthology K10751) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY083457 IRAL008K17 pOTB7 BC001143 NM_005441 Partial
HGY087119 IRAL017N07 pOTB7 BC021218 NM_005441 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE041256 W01A103C08 pENTR-TOPO IRAL017N07 BC021218 NM_005441  
HGE041260 W01A103C12 pENTR-TOPO IRAL017N07 BC021218 NM_005441  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR388573 RBd71H05 pGCAP10 NM_005441.2  
GGCGCGCGGGAAGCGGCGCGCGCTGCGCGGGAGGTGACGGTGCCTCTGACTGTCCGGGTC
HKR388830 RBd72B06 pGCAP10 NM_005441.2  
GGCGGGAGGTGACGGTGCCTCTGACTGTCCGGGTCCCTCCAGCATTTTGCAGCTTTCTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl