Prev. |  KEGG KO K04664 > 

RIKEN DNA Bank Human Resource - GDF5

Gene ID NCBI Gene 8200 |  KEGG hsa:8200
Gene Symbol GDF5
Protein Name growth differentiation factor 5
Synonyms BDA1C|BMP-14|BMP14|CDMP1|LAP-4|LAP4|OS5|SYM1B|SYNS2
Ortholog resources KEGG ortholog (KEGG orthology K04664) in the DNA Bank
Featured content Hippo signaling (human)
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025984 IRAK064P24 pCMV-SPORT6 BC032495 NM_000557 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE007563 W01A018P03 pENTR-TOPO IRAK064P24 BC032495 NM_000557  
HGE007565 W01A018P05 pENTR-TOPO IRAK064P24 BC032495 NM_000557  
HGE007567 W01A018P07 pENTR-TOPO IRAK064P24 BC032495 NM_000557  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249081 ARiS122L17 pGCAP10 NM_000557.2  
TGTTTTTTCAGCTGCTGACTGGAGACGGTGCACGTCTGGATACGAGAGCATTTCCACTAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.16

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl