Prev. |  KEGG KO K09492 > 

RIKEN DNA Bank Human Resource - MKKS

Gene ID NCBI Gene 8195 |  KEGG hsa:8195
Gene Symbol MKKS
Protein Name McKusick-Kaufman syndrome
Synonyms BBS6|HMCS|KMS|MKS
Ortholog resource in our bank

  MKKS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX016839 IRAK042B15 pCMV-SPORT6 BC028973 NM_170784 Full/var
HGY090221 IRAL025J05 pOTB7 BC009180 NM_170784 Partial/var
HGY092777 IRAL031P17 pDNR-LIB BC013287 NM_170784 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR276671 ARiS191L07 pGCAP10 NM_018848.2  
GGAAGGTTGTCGGGATCCGCGGCAGCAGCGGCTGCTTGAGATCTGTTTCTGGGGCCTCTG
HKR333307 RBb33E11 pGCAP1 NM_018848.2  
HKR337236 RBb43B12 pGCAP1 NM_018848.2  
AATGTGGGCTTGAGATCTGTTTCTGGGGCCTCTGGCGGTGGCGGCCTGGGGCGGCGCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl