Prev. |  KEGG KO K01358 > 

RIKEN DNA Bank Human Resource - CLPP

Gene ID NCBI Gene 8192 |  KEGG hsa:8192
Gene Symbol CLPP
Protein Name caseinolytic mitochondrial matrix peptidase proteolytic subunit
Synonyms DFNB81|PRLTS3
Ortholog resource in our bank

  CLPP

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083300 IRAL008E04 pOTB7 BC002956 NM_006012 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR068906 ARe72E10 pKA1U5 NM_006012.2  
GCCGGGTGGCGTCATGCAGGTACCCCGCGCTGGGGCCTCGCCTCGCCGCTCACTTTCCAG
HKR218022 ARiS045A22 pGCAP10 NM_006012.2  
TTGGGGGGGCTCCGGGCTGGGTGGGGATCGGCTGGCTGCCCCCGGCCCCTCACCTCCATC
HKR238776 ARiS096P16 pGCAP10 NM_006012.2  
GAGCGCAGCGGCCGCCGCAGCGGACACTCCAGAACGGCCTGGCCCTGCAGCGGTGCCTGC
HKR367704 RBd19E08 pGCAP10 NM_006012.2  
GCGGGCGGGGACACGGTTCGGGGGCTCCGGGCTGGGTGGGGATCGGCTGGCTGCCCCCGG
HKR368930 RBd22F10 pGCAP10 NM_006012.2  

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl