Prev. |  KEGG KO K12826 > 

RIKEN DNA Bank Human Resource - SF3A2

Gene ID NCBI Gene 8175 |  KEGG hsa:8175
Gene Symbol SF3A2
Protein Name splicing factor 3a subunit 2
Synonyms PRP11|PRPF11|SAP62|SF3a66
Ortholog resource in our bank

  SF3A2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080954 IRAL002G10 pOTB7 BC009903 NM_007165 Full
HGY083909 IRAL009M21 pOTB7 BC004434 NM_007165 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006978 W01A017H10 pENTR-TOPO IRAL009M21 BC004434 NM_007165  
HGE018598 W01A046I06 pENTR-TOPO IRAL002G10 BC009903 NM_007165  
HGE018600 W01A046I08 pENTR-TOPO IRAL002G10 BC009903 NM_007165  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405784 RBdS014H16 pGCAP10 NM_007165.4  
AAAACGAAGTCGTGGAGGTGGCGAAACGAGGAGGAGATAACGCGGCCTTGGGCTCTGGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl