Prev. | Human A to Z list > M > 

RIKEN DNA Bank Human Resource - MADCAM1

Gene ID (NCBI) 8174
Gene Symbol MADCAM1
Protein Name mucosal vascular addressin cell adhesion molecule 1
Synonyms MACAM1
Databases KEGG hsa:8174 |  NCBI Gene 8174
Featured content Intestinal immune network for IgA production - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K06779)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398171 RBd95H03 pGCAP10 NM_130760.2  
GAGTGAGCTGCACCCGCGGAAAAGGAGGGGGAGCGGCTGGTCAGCTGCGCCCTGCGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.06.19

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl